Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
➤ Gửi thông báo lỗi ⚠️ Báo cáo tài liệu vi phạmNội dung chi tiết: Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
-----------------------------------JOURNAL OF MEDICAL RESEARCHRAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOG Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsGREL AND ASPIRIN FOR PCI STENT GRAFT PATIENTSNguyen Thi Trang, Luong Thi Lan Anh , Vu To Giang , Do Due Huy, Nguyen Thi Minh Ngoc, Department of Biomedical and Genetics. Hanoi Medical University. Hanoi. VietnamThe response io clopidogrel and aspirin in patients is known to be highly variable as bioa Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsvailability is dependent upon the conversion of the prodrug into the pharmacologically active clopidogrel and aspirin. Blood samples were collected frRapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
om consenting patients after they were on the maintenance dose of anti-platelet therapy. The real-time PCR method was developed for the identification-----------------------------------JOURNAL OF MEDICAL RESEARCHRAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOG Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsidated against the Sanger's sequencing method described previously and used to determine the frequency and type of mutations of postPCI patients. The results indicated that patients carrying any CYP2C19 loss-of-function alleles had a higher event rate (52.5%) of the study group: 10% homozygous and 3 Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients5% heterozygous (CYP2C19 *2); 7.5% heterozygous carriers (CYP2C19'3). Carriers of the Leu33Pro polymorphism of ITGB3 gene accounted for approximatelyRapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
10% of the study population. In conclusion, a genotyping variant of c YP2C19 and ITGB3 provides an excellent opportunity for optimizing the anti-plate-----------------------------------JOURNAL OF MEDICAL RESEARCHRAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOG Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsthe most common type of heart disease. It is the leading cause of death in the world in both men and women [1], In Vietnam, coronary artery disease has been increasing rapidly in recent years. Percutaneous coronary intervention (PCI) is one of the most common medical procedures performed for treatme Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsnt of CAD.Corresponding author: Nguyen Thi Trang, Department of Biomedical and Genetics, Hanoi Medical University Email: trangnguyen@hmu.edu.vnReceiveRapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
d: 03 June 2017Accepted: 16 November 2017Dual antiplatelet therapy with aspirin and a P2Y12 receptor antagonist including clopidogrel is the standard -----------------------------------JOURNAL OF MEDICAL RESEARCHRAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOG Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsascular events. However, the substantial variability in pharmacodynamics response, as well as the moderate antiplatelet efficacy of clopidogrel and aspirin, has raised major concerns. Many researches have focused on the impact of genetic polymorphisms encoding transport systems or enzymes involved i Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsn the absorption and metabolismJMR 111 E2(2)-20181JOURNAL OF MEDICAL RESEARCH---------of these drugs. An ESC Guidelines class II recommendation has beRapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
en given for the management of acute coronary syndromes patients (2011) to perform genotyping in high-risk PCI patients if a change in the antiplatele-----------------------------------JOURNAL OF MEDICAL RESEARCHRAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOG Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientskinetics and antiplatelet response to clopidogrel. CYP2C19 G681A (’2) and CYP2C19 G636A (‘3) alleles are associated with CYP function reduction, impaired clopidogrel responsiveness and increased subsequent post-PCI ischemic outcomes [3 - 5].The GPIIb/llla receptor is a key regulator of platelet aggr Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsegation. Consequently, polymorphisms within the GPIIb/llla receptor have been of great interest with regard to aspirin resistance, the mostII.MATERIALRapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
S AND METHODScommonly investigated being the PIA1/A2 SNP (Leu33Pro) [6]. Some studies have suggested an association between the presence of the PIA2 a-----------------------------------JOURNAL OF MEDICAL RESEARCHRAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOG Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientse way of defining polymorphism, with the advantage of relatively simple, fast-paced techniques that have opened up new possibilities for applying this technique as a routine test before indications of clopidogrel and aspirin therapy for PCI patients. The aim of this study was to investigate the freq Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsuencies of CYP2C19 G681A (‘2; rs4244285). CYP2C19 G636A (•3; rs4986893) and PIA1/ PIA2 (T1565C, rs5918) polymorphisms of CYP2C19 and ITGB3 gene in stuRapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
dy subjects by Realtime - PCR technique.1Sample collection:40 patients undergoing PCI procedure with coronary artery disease were offered the genetic -----------------------------------JOURNAL OF MEDICAL RESEARCHRAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOG Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patientsloading dose before the procedure.2Method:About 3 ml of venous blood were collected in a tube containing EDTA. Peripheral blood leucocytes were separated by centrifugation. DNA was extracted from peripheral blood with DNA Expression Kit (Lytech, Russia). Realtime - PCR technique was used to identify Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients polymorphism of CYP2C19 gene (CYP2C19’2 , CYP2C19’3) and ITGB3 gene (PIA1 / PIA2). The primers used for PCR of each polymorphism are given in Table 1Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients
:2JMR 111 E2 (2) - 2018■JOURNAL OF MEDICAL RESEARCHTable 1. FP - Forward primer, ASP - Allele specific primer, RP- Reverse primer.GenePrimerFP5- - CCC-----------------------------------JOURNAL OF MEDICAL RESEARCHRAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOG Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients3 ÍG636A1ASP5 - GGATTGTAAGCACCCCCAGA- 3’RP5’ - TCACCCCATGGCTGTCTAGG - 3’Leu33ProFP5' - GCTCCAATGTACGGGGTAAAC - 3’-----------------------------------JOURNAL OF MEDICAL RESEARCHRAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOGGọi ngay
Chat zalo
Facebook